A FASTQ file normally uses four lines per sequence. Line 1 begins with a ‘@’ character and is followed by a sequence identifier and an optional description (like a FASTA title line). Line 2 is the raw sequence letters. Line 3 begins with a ‘+’ character and is optionally followed by the same sequence identifier (and any description) again. Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
An example FASTQ file
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!”*((((***+))%%%++)(%%%%).1***-+*”))**55CCF>>>>>>CCCCCCC65
A more detailed explanation of the FASTQ file format can be found on Wikipedia following this link. The Wikipedia page has information helpful for determining how to distinguish between various versions of the FASTQ file format.